Why isn’t my reverse primer found directly?

The reverse primer is written 5′→3′ for the bottom strand, so its sequence does not appear on the top strand — its reverse complement does. The tool searches for that automatically.

Does it allow mismatches?

No. It requires an exact primer match in the correct orientation. Real PCR tolerates some 5′ mismatches; if a primer is not found, check for typos or degenerate bases.

Amplicon size calculator

Predict the size of a PCR product from a primer pair and template — locate the forward primer and the reverse-complement of the reverse primer to get the amplicon length in bp.

How it works

Formula

Find the forward primer on the template. Find the reverse complement of the reverse primer downstream of it. The amplicon runs from the start of the forward primer to the end of the reverse-primer site: length = (reverse site end) − (forward start).

Worked example

Template TTATGCCCGGGCCCAAAAAACCCGG, forward ATGCCC (at base 3), reverse GGGTTT (its reverse complement AAACCC ends at base 23): the product spans bases 3–23 = 21 bp.

When to use it

To predict the band size before running a gel, confirm a primer pair amplifies the intended region, or check that primers bind in the right orientation on a cloned sequence.

Sensible defaults

The default is a small worked example giving a 21 bp product. Paste your real template and primers to get the expected size.

FAQ

Why isn’t my reverse primer found directly?: The reverse primer is written 5′→3′ for the bottom strand, so its sequence does not appear on the top strand — its reverse complement does. The tool searches for that automatically.
Does it allow mismatches?: No. It requires an exact primer match in the correct orientation. Real PCR tolerates some 5′ mismatches; if a primer is not found, check for typos or degenerate bases.