Predicting amplicon size from primers

Before running a gel you can work out exactly how big your PCR product should be. The amplicon runs from where the forward primer sits to where the reverse primer sits — and knowing the expected band tells you whether the reaction worked.

Where the primers sit

The forward primer matches the top strand as written, so you find it directly in the template. The reverse primer is written 5′→3′ for the bottom strand, so its sequence does not appear on the top strand — itsreverse complement does. That is the site you look for, downstream of the forward primer.

The length

The product spans from the first base of the forward primer to the last base of the reverse-primer site:

amplicon length = (end of reverse site) − (start of forward primer)

On the template TTATGCCCGGGCCCAAAAAACCCGG, with forward ATGCCC starting at base 3 and reverse GGGTTT (whose reverse complement AAACCC ends at base 23), the product spans bases 3–23 = 21 bp. The primers themselves are part of the product — they are incorporated into it.

Why it’s worth checking

An unexpected band size is a fast diagnostic. A product much smaller than predicted often means primer-dimers or mispriming; a larger one can mean an intron, an insertion, or the wrong binding site. Confirming the predicted size in silico first tells you what a correct result should look like.

Exact matches only

In-silico prediction here requires the primers to be present exactly and in the right orientation. Real PCR tolerates some 5′ mismatch, so if a primer isn’t found, check for a typo, a degenerate base, or that you pasted the correct strand before assuming the pair won’t amplify.